Funded by the NIH  •  Developed at the University of Washington, Seattle

Hermansky-Pudlak Syndrome

[Includes: Hermansky-Pudlak Syndrome 1, Hermansky-Pudlak Syndrome 2, Hermansky-Pudlak Syndrome 3, Hermansky-Pudlak Syndrome 4, Hermansky-Pudlak Syndrome 5, Hermansky-Pudlak Syndrome 6, Hermansky-Pudlak Syndrome 7, Hermansky-Pudlak Syndrome 8]

Summary

Disease characteristics.  Hermansky-Pudlak syndrome (HPS) is a multi-system disorder characterized by tyrosinase-positive oculocutaneous albinism, a bleeding diathesis resulting from a platelet storage pool deficiency, and, in some cases, pulmonary fibrosis or granulomatous colitis. The albinism is characterized by hypopigmentation of the skin and hair and the ocular findings of reduced iris pigment with iris transillumination, reduced retinal pigment, foveal hypoplasia with significant reduction in visual acuity (usually in the range of 20/50 to 20/400), nystagmus, and increased crossing of the optic nerve fibers. Hair color ranges from white to brown; skin color ranges from white to olive and is usually a shade lighter than that of other family members. The bleeding diathesis can result in easy bruising, frequent epistaxis, gingival bleeding, postpartum hemorrhage, colonic bleeding, and prolonged bleeding with menses or after tooth extraction, circumcision, and other surgeries. Pulmonary fibrosis, a restrictive lung disease, typically causes symptoms in the early thirties and progresses to death within a decade. Granulomatous colitis is severe in about 15% of affected individuals.

Diagnosis/testing.  The diagnosis of HPS is established by clinical findings of hypopigmentation of the skin and hair, characteristic eye findings, and demonstration of absent dense bodies on whole mount electron microscopy of platelets. Molecular genetic testing of the HPS1 gene is available on a clinical basis for individuals from northwestern Puerto Rico. Molecular testing of the HPS3 gene is available on a clinical basis for individuals of central Puerto Rican or Ashkenazi Jewish heritage. Sequence analysis is available on a clinical basis for mutations in HPS1 and HPS4. Diagnosis of individuals with other types of HPS is available on a research basis only.

Management.  Treatment of manifestations: correction of refractive errors and use of low vision aids; thrombin-soaked gelfoam for skin wounds with prolonged bleeding; DDAVP (1-desamino-8-D-arginine vasopressin) for wisdom tooth extraction and invasive procedures; platelet or red blood cell transfusions for surgery or protracted bleeding; supplemental oxygen for severe pulmonary disease; steroids, other anti-inflammatory agents and/or Remicade^® for granulomatous colitis. Prevention of secondary complications: protection of the skin from the sun; wearing a medical alert bracelet that explicitly describes the functional platelet defect; maximizing pulmonary function before development of pulmonary fibrosis by prompt treatment of pulmonary infections, immunizing with influenza and pneumococcal vaccines, and regular moderate exercise. Surveillance: annual ophthalmologic examination; at least annual examination of the skin for solar keratoses (premalignant lesions), basal cell carcinoma, squamous cell carcinoma; annual pulmonary function testing in those over age 20 years; routine history for symptoms of colitis (e.g., cramping, increased mucus in the stool, rectal bleeding). Agents/circumstances to avoid: aspirin-containing products, cigarette smoke. Testing of relatives at risk: In rare families with HPS3, HPS5, or HPS6, the evaluation of apparently unaffected siblings may yield a positive diagnosis.

Genetic counseling.  HPS is inherited in an autosomal recessive manner. At conception, each sib of an affected individual has a 25% chance of being affected, a 50% chance of being an asymptomatic carrier, and a 25% chance of being unaffected and not a carrier. Prenatal diagnosis is available, but only for those families in which mutations have been identified in an affected individual.

Diagnosis

Clinical Diagnosis

The diagnosis of Hermansky-Pudlak syndrome (HPS) is established by clinical findings of oculocutaneous albinism in combination with a bleeding diathesis of variable severity [Gahl et al 1998].

The diagnosis of oculocutaneous albinism is established by finding hypopigmentation of the skin and hair on physical examination associated with the following characteristic ocular findings:

• Nystagmus
• Reduced iris pigment with iris transillumination
• Reduced retinal pigment on fundoscopic examination
• Foveal hypoplasia associated with significant reduction in visual acuity
• Increased crossing of the optic nerve fibers [King et al 2001]

Testing

Absence of platelet dense bodies.  Currently, the sine qua non for diagnosis of HPS is absence of dense bodies on whole mount electron microscopy of platelets [Witkop et al 1987]. Upon stimulation of platelets, the dense bodies, which contain ADP, ATP, serotonin, calcium, and phosphate, release their contents to attract other platelets. This process constitutes the secondary aggregation response, which cannot occur in the absence of the dense bodies. There are normally four to eight dense bodies per platelet, but there are none in the platelets of individuals with HPS.

Coagulation studies

• The secondary aggregation response of platelets is impaired.
• Bleeding time is generally prolonged.
• Coagulation factor activity and platelet counts are normal.

Ceroid lipofuscin.  The demonstration of a yellow, autofluorescent, amorphous lipid-protein complex, called ceroid lipofuscin, in urinary sediment and parenchymal cells is characteristic of HPS, but this laboratory finding is virtually never used in diagnosis.

Molecular Genetic Testing

GeneReviews designates a molecular genetic test as clinically available only if the test is listed in the GeneTests Laboratory Directory by either a US CLIA-licensed laboratory or a non-US clinical laboratory. GeneTests does not verify laboratory-submitted information or warrant any aspect of a laboratory's licensure or performance. Clinicians must communicate directly with the laboratories to verify information. —ED.

Genes.  The HPS1, AP3B1, HPS3, HPS4, HPS5, HPS6, DTNBP1, and BLOC1S3 genes are known to be associated with HPS.

Other loci.  Most likely, mutations in other genes also result in HPS.

Clinical uses

• Confirmatory diagnostic testing
• Carrier testing
• Prenatal diagnosis

Clinical testing

• Deletion/duplication analysis

  • HPS1.  Homozygosity for a 16-bp duplication is found in approximately 75% of all affected individuals of Puerto Rican ancestry [Santiago Borrero et al 2006] and in virtually all affected individuals from northwestern Puerto Rico [Oh et al 1996 , Huizing & Gahl 2002]. To date, the 16-bp duplication has not been reported in affected individuals not of Puerto Rican ancestry. This duplication is designated c.1470_1486dupCCAGCAGGGGAGGCCC, c.1470_1468dup16.

  • HPS3.  Homozygosity for g.339_4260del3904, GenBank reference sequence AF375663 (also known as the 3.9-kb deletion) has been identified in affected individuals of Puerto Rican ancestry only [Anikster et al 2001].

• Targeted mutation analysis

  • HPS3.  Homozygosity for c.1163+1G>A (also known as 1303+1G>A) splice site mutation has been identified in affected individuals of Ashkenazi Jewish ancestry only [Huizing, Anikster, Fitzpatrick et al 2001].

• Sequence analysis

  • HPS1.  The HPS1 gene is mutated in virtually all affected individuals from northwestern Puerto Rico and in approximately 45% of affected non-Puerto Ricans [Oh et al 1996 , Oh et al 1998 , Shotelersuk et al 1998 , Shotelersuk & Gahl 1998 , Oetting & King 1999 , Hermos et al 2002 , Huizing & Gahl 2002]. Homozygotes as well as compound heterozygotes for HPS1 mutations have been identified.

  • HPS4.  Mutations in the gene HPS4 have been reported in 15 affected individuals [Suzuki et al 2002 , Anderson et al 2003], including a Sri Lankan [Bachli et al 2004].

Research testing

• Direct DNA.  Molecular genetic testing for AP3B1, HPS3, HPS6, DTNBP1, and BLOC1S3 mutations — with the exception of HPS3 mutations g.339_4260del3904, AF375663 (also known as 3.9-kb deletion) and c.1163+1G>A (also known as 1303+1G>A) — is available on a research basis only and requires mutation scanning or sequence  analysis .

  • AP3B1.  Mutations in the AP3B1 gene have been identified in several individuals: two adult brothers [Dell'Angelica et al 1999], a six-year-old boy [Huizing et al 2002], another child [Clark et al 2003], two siblings of a consanguineous Turkish mating [Jung et al 2006], two Italian siblings [Fontana et al 2006], and a child originally diagnosed with Griscelli syndrome [Enders et al 2006].

  • HPS3.  Homozygosity for a unique g.339_4260del3904, AF375663 (also known as 3.9-kb deletion) has been found in 100% of affected individuals from the region of central Puerto Rico near Aibonito [Anikster et al 2001].

    Individuals with HPS who are of Ashkenazi Jewish background have a unique c.1163+1G>A, AY033141 (also known as 1301+G>A or IVS5+1G>A) splice site mutation [Huizing, Anikster, Fitzpatrick et al 2001]. Of six individuals with this mutation, four were homozygotes and two were compound heterozygotes.

  • HPS5.  Mutations in HPS5 have been found in five individuals. The mutations include a homozygous four-base deletion in a three-year-old Turkish boy [Zhang et al 2003], homozygous missense mutations in 51- and 43-year-old sisters of Swiss extraction [Huizing et al 2004], compound heterozygous insertions in a 21-year-old woman of English and Irish background [Huizing et al 2004], and compound heterozygous deletion/nonsense mutations in a ten-year-old boy of English, Irish, Dutch, and Swedish background [Huizing et al 2004].

  • HPS6.  Only one mutation in HPS6 has been reported. A 39-year-old Belgian woman carried a homozygous four-base deletion [Zhang et al 2003]. Four other individuals with HPS6 mutations have been identified but not reported.

  • DTNBP1.  A 48-year-old Portuguese woman with HPS7 exhibited a homozygous nonsense  mutation in DTNBP1.

  • BLOC1S3.  A single family in Britain was identified with a homozygous frameshift  mutation in BLOC1S3 [Morgan et al 2006].

Table 1 summarizes molecular genetic testing for this disorder.

Table 1. Molecular Genetic Testing Used in HPS Test Method Mutations Detected Mutation Detection Frequency  1 Test Availability Puerto Rican Non-Puerto Rican Deletion/duplication analysis HPS1 c.1470_1468dup16 ~75% Clinical HPS3 g.339_4260del3904, AF375663 ~25% Clinical Targeted mutation analysis HPS3 c.1163+1G>A splice mutation ~5%  2 Sequence analysis Other HPS1 sequence variants ~45% Clinical HPS4 sequence variants ~15% Clinical Direct DNA  3 AP3B1 sequence variants ~6% Research only Other HPS3 sequence variants ~15% HPS5 sequence variants ~5% HPS6 sequence variants ~4% DTNBP1 sequence variants 1% BLOC1S3 sequence variants 0 4%

1. Proportion of affected individuals with a mutation(s) as classified by gene, population group, and/or test method 2. All Ashkenazi Jewish 3. Direct DNA refers to the use of mutation analysis, mutation scanning, sequence analysis, or other means of molecular genetic testing to detect a genetic alteration associated with a specific disorder.

Interpretation of test results.  For issues to consider in interpretation of sequence analysis results, click here.

Genetically Related (Allelic) Disorders

No other phenotypes are known to be caused by mutations in HPS1, AP3B1, HPS3, HPS4, HPS5, HPS6, DTNBP1, or BLOC1S3.

Clinical Description

Natural History

The clinical characteristics of Hermansky-Pudlak syndrome (HPS) consist of oculocutaneous albinism, a bleeding diathesis, a platelet storage pool deficiency, and other organ involvement [Huizing, Anikster, & Gahl 2001 ; Huizing & Gahl 2002]. Signs and symptoms of oculocutaneous albinism in HPS are variable but visual acuity generally remains stable.

Eyes.  Nearly all children with the albinism of HPS have nystagmus at birth, often noticed by the parents in the delivery room and by the examining physician. Children with HPS may also have periodic alternating nystagmus [Gradstein et al 2005], wandering eye movements, and lack of visual attention. The initial diagnosis of albinism is sometimes made by the ophthalmologist.

The nystagmus can be very fast early in life, and generally slows with time, but nearly all individuals with albinism have nystagmus throughout their lives. The development of pigment in the iris or retina does not affect the nystagmus. Nystagmus is most noticeable when an individual is tired, angry, or anxious, and less marked when s/he is well rested and relaxed.

Photophobia may accompany severe foveal hypoplasia.

Iris color may remain blue or change to a green/hazel or brown/tan color. Globe transillumination can be complete or can show peripupillary clumps or streaks of pigment in the iris that appear like spokes of a wagon wheel. Fine granular pigment may develop in the retina.

Visual acuity, usually between 20/50 and 20/400, is typically 20/200 and usually remains constant after early childhood [Iwata et al 2000].

Alternating strabismus is found in most individuals with albinism and is generally not associated with the development of amblyopia.

Skin/hair.  The hair color ranges from white to brown, and can occasionally darken with age. Skin color can be white to olive, but is generally at least a shade lighter than that of other family members.

Over many years, exposure to the sun of lightly pigmented skin can result in coarse, rough, thickened skin (pachydermia), solar keratoses (premalignant lesions), and skin cancer. Both basal cell carcinoma and squamous cell carcinoma can develop. Although skin melanocytes are present in individuals with HPS, melanoma is rare.

Affected Puerto Ricans typically have solar damage manifesting as actinic keratoses and nevi. Ephelids, lentigines, and basal cell carcinoma also occur with increased frequency among Puerto Ricans with HPS [Toro et al 1999].

Bleeding diathesis.  The bleeding diathesis of HPS results from absent or severely deficient dense granules in platelets; the alpha granule contingent is normal [Huizing et al 2007]. Affected individuals experience variable bruising, epistaxis, gingival bleeding, postpartum hemorrhage, colonic bleeding, and prolonged bleeding during menstruation or after tooth extraction, circumcision, or other surgeries. Typically, cuts bleed longer than usual but heal normally. Bruising generally first appears at the time of ambulation. Epistaxis occurs in childhood and diminishes after adolescence. Menstrual cycles may be heavy and irregular. Prolonged bleeding after tooth extraction can lead to the diagnosis of HPS. Affected individuals with colitis may bleed excessively per rectum. Exsanguination as a complication of childbirth, trauma, or surgery is extremely rare.

Pulmonary fibrosis.  The pulmonary fibrosis of HPS typically causes symptoms in the thirties and is fatal within a decade. The pulmonary fibrosis has been described largely in individuals with HPS1 from northwestern Puerto Rico [Brantly et al 2000 , Avila et al 2002], but also occurs in other individuals with HPS1 [Brantly et al 2000 , Hermos et al 2002] or HPS4 [Anderson et al 2003 , Bachli et al 2004]. To date, convincing evidence of pulmonary fibrosis has not been reported for HPS3, HPS5, or HPS6. The fibrosis consists of progressive, restrictive lung disease with an extremely variable time course [Gahl et al 1998 , Brantly et al 2000 , Gahl et al 2002].

Colitis.  A bleeding granulomatous colitis resembling Crohn's disease presents, on average, at age 15 years, with wide variability [Gahl et al 1998]. The colitis is severe in 15% of cases and occasionally requires colectomy; affected individuals may have the inflammatory bowel disease of HPS without the explicit diagnosis of colitis. Objective signs of colitis have been found primarily in persons with HPS1 or HPS4 [Hussain et al 2006]. Although the colon is primarily involved in HPS, any part of the alimentary tract, including the gingiva, can be affected.

Other.  Cardiomyopathy and renal failure have also been reported in HPS [Witkop et al 1989].

Neutropenia and/or immune defects have been associated with HPS2 [Shotelersuk et al 2000 , Huizing & Gahl 2002 , Clark et al 2003 , Fontana et al 2006].

Pathogenesis.  Pulmonary fibrosis, granulomatous colitis, cardiomyopathy, and renal failure have been attributed to the lysosomal accumulation of ceroid lipofuscin, but this relationship is speculative.

Genotype-Phenotype Correlations

Correlations between specific HPS-causing mutations and particular clinical presentations are not convincing.

The pulmonary fibrosis of HPS is associated with Puerto Ricans homozygous for the c.1470_1468dup16 mutation in HPS1 [Gahl et al 1998]. However, the occurrence of lethal pulmonary fibrosis in an Irish individual with HPS1 mutations [Brantly et al 2000] and in Sri Lankan [Bachli et al 2004] and Eastern European [Anderson et al 2003] individuals with HPS4 mutations suggests that any HPS1 or HPS4 mutation can cause pulmonary disease. Pulmonary fibrosis did not occur in one study of four individuals with HPS5 [Huizing et al 2007].

Two brothers and a six-year-old boy with compound heterozygosity for AP3B1 mutations had typical HPS but also persistent neutropenia and an increased frequency of infections in childhood [Shotelersuk et al 2000 , Huizing & Gahl 2002]. No clinical information is available on a fourth individual with AP3B1 mutations [Clark et al 2003]. A two-year-old boy diagnosed with HPS2 had fatal hemophagocytic lymphohistiocytosis [Enders et al 2006], and two Italian siblings had an immune defect involving abnormal natural killer cell function [Fontana et al 2006]. Two Turkish siblings with HPS2 manifested developmental delay and dysmorphic features, but consanguinity was also involved [Jung et al 2006].

Individuals with HPS3 mutations have milder symptoms than those with HPS1 mutations [Huizing, Anikster, Fitzpatrick et al 2001]. The albinism in HPS3 is characterized by such minimal hypopigmentation that some individuals have carried the diagnosis of ocular albinism rather than oculocutaneous albinism. Visual acuity often approximates 20/100 or better. Bleeding is also mild and pulmonary involvement has not been observed. Significant granulomatous colitis occurs primarily in HPS1 and HPS4 [Hussain et al 2006]. The severity of clinical symptoms does not appear to correlate with the severity of the molecular defect.

The variability and severity of oculocutaneous albinism and bleeding diathesis found in HPS4 are similar to those of HPS1 [Suzuki et al 2002 , Anderson et al 2003]. Pulmonary fibrosis and granulomatous colitis also occur in HPS4; no correlation has been found between the severity of symptoms and specific mutations.

HPS5 and HPS6 appear to resemble HPS3 in their mildness and lack of pulmonary disease. It is difficult to discern the severity of HPS7 and HPS8 based upon the single case reported for each.

Nomenclature

HPS may have been referred to as non-neuronal ceroid-lipofuscinosis to differentiate it from neuronal ceroid-lipofuscinosis or Batten disease. In HPS, the nervous system is spared.

Individuals with HPS with mild hypopigmentation but a bleeding disorder could be referred to as having "delta storage pool deficiency"; however, individuals with isolated delta storage pool deficiency do not have vision defects.

Prevalence

HPS occurs worldwide and has an estimated prevalence of one in 500,000 to one in 1,000,000 in non-Puerto Rican populations.

Prevalence of HPS1 in northwestern Puerto Rico is one in 1800. HPS1 has been reported in a small isolate in a Swiss village and as a genetic isolate in Japan [Ito et al 2005].

HPS3 occurs as a genetic isolate in central Puerto Rico [Anikster et al 2001 , Santiago Borrero et al 2006].

Differential Diagnosis

For current information on availability of genetic testing for disorders included in this section, see GeneTests Laboratory Directory. —ED.

Albinism.  The diagnosis of Hermansky-Pudlak syndrome (HPS) should be considered in anyone with oculocutaneous albinism or ocular albinism, as the bleeding diathesis can be mild, unrecognized, or previously disregarded. It may be reasonable to screen all individuals with albinism for HPS by examining their platelets for absent dense bodies. Disorders with albinism included in the differential diagnosis:

• Oculocutaneous albinism type 1 (OCA1) is caused by mutations in the TYR gene. Ocular findings include nystagmus, reduced iris pigment with iris translucency, reduced retinal pigment, foveal hypoplasia with significantly reduced visual acuity usually in the range of 20/100 to 20/400, and misrouting of the optic nerves resulting in alternating strabismus and reduced stereoscopic vision. Individuals with OCA1A have white hair, white skin that does not tan, and fully translucent irises that do not darken with age. At birth, individuals with OCA1B have white or very light yellow hair that darkens with age, white skin that over time develops some generalized pigment and may tan with sun exposure, and blue irises that change to green/hazel or brown/tan with age. Visual acuity may be 20/60 or better in some individuals.

• Oculocutaneous albinism type 2 (OCA2) is caused by mutations in the OCA2 gene. Affected individuals usually have pigmented hair at birth and usually do not tan later in life, but some have been identified who have white hair at birth. They may develop pigmented nevi and freckles, but the skin does not develop generalized pigment. The irises usually develop some pigment that can be seen by the hazel/green to tan/brown color or by globe transillumination.

• Oculocutaneous albinism type 4 (OCA4) is caused by mutation in the SLC45A2 gene (also known as MAPT, membrane-associated transporter protein). OCA4 was initially identified in one male of Turkish origin. Studies now suggest that this is the second most common type of OCA in Japanese individuals. The phenotype is similar to that of OCA2 in Caucasian individuals.

• X-linked ocular albinism (XLOA) is caused by mutations in the GPR143 gene. Affected males have congenital and persistent visual impairment. XLOA is characterized by congenital nystagmus, reduced visual acuity, hypopigmentation of the iris pigment epithelium and the ocular fundus, and foveal hypoplasia. Significant refractive errors, reduced or absent binocular functions, photoaversion, and strabismus are common. Skin and hair pigment are normal.

Disorders of platelet dense bodies.  Described in a recent review [Gunay-Aygun et al 2004], these disorders include the following:

• Chediak-Higashi syndrome.  Affected individuals have a significantly increased frequency of infection in childhood, mild oculocutaneous albinism, and a bleeding diathesis [Introne et al 1999]. This entity is characterized by huge, fused, dysfunctional lysosomes and macromelanosomes. Individuals with Chediak-Higashi syndrome always have giant intracellular granules in their neutrophils on a peripheral blood smear; individuals with HPS never exhibit this finding. Also, persons with Chediak-Higashi syndrome often develop a fatal lymphohistiocytosis or the accelerated phase; this has been reported in only a single person with HPS, i.e., one with HPS2 [Enders et al 2006]. Without bone marrow transplantation (BMT), individuals with classic Chediak-Higashi syndrome die in childhood.

• Griscelli syndrome.  Affected individuals have mild hypopigmentation and immunodeficiency and can have the accelerated phase of lymphohistiocytosis. A distinguishing finding is silvery-gray hair.

  Note: Elejalde syndrome is now considered to be a type of Griscelli syndrome in which neurologic involvement, rather than immunodeficiency and lymphohistiocytosis, occurs.

• Cross syndrome [Huizing et al 2000b]. Affected individuals have hypopigmentation, ocular anomalies, and severe central nervous system involvement with developmental delay; the latter findings are not part of Hermansky-Pudlak syndrome.

• Pulmonary fibrosis.  Individuals with familial pulmonary fibrosis do not have hypopigmentation, visual defects, or a bleeding diathesis; the only feature shared with HPS is a diathesis toward interstitial lung disease.

• Lymphohistiocytosis.  See Familial Hemophagocytic Lymphohistiocytosis and X-Linked Lymphoproliferative Disease (XLP).

Management

Evaluations Following Initial Diagnosis

To establish the extent of disease in an individual diagnosed with Hermansky-Pudlak syndrome (HPS):

• Complete ophthalmologic evaluation
• Skin examination for severity of hypopigmentation and, after infancy, for evidence of skin damage and skin cancer
• History of bleeding problems, symptoms suggesting pulmonary fibrosis and/or colitis. For evaluation for lung fibrosis, pulmonary function tests (PFTs) should be performed in individuals older than age 20 years.

Treatment of Manifestations

Eyes

• The majority of individuals with albinism have significant hyperopia (far-sightedness) or myopia (near-sightedness), and astigmatism. Correction of these refractive errors can improve visual acuity.
• Strabismus surgery is usually not required but can be performed for cosmetic purposes, particularly if the strabismus is marked or fixed. The surgery is not always successful.
• Aids such as hand-held magnifying devices or bioptic lenses are helpful adjuncts in the care of visually impaired individuals with HPS.
• Preferential seating in school is beneficial, and a vision consultant may be useful.

Skin.  Treatment of skin cancer does not differ from that in the general population.

Bleeding

• Humidifiers may reduce the frequency of nosebleeds; oral contraceptives can limit the duration of menstrual periods. A levonorgestrel-releasing intrauterine system has been used with benefit for control of menorrhagia in a woman with HPS [Kingman et al 2004].
• Treatment of minor cuts includes placing thrombin-soaked gelfoam over an open wound that fails to clot spontaneously.
• For more invasive trauma, such as wisdom tooth extraction, DDAVP (1-desamino-8-D-arginine vasopressin, 0.2 µg/kg in 50 mL of normal saline) can be given as a 30-minute intravenous infusion just prior to the procedure. The use of DDAVP may or may not improve the bleeding time [Cordova et al 2005]. For extensive surgeries or protracted bleeding, platelet or red blood cell transfusions may be required.

Pulmonary fibrosis

• When the pulmonary disease becomes severe, oxygen therapy can be palliative.
• One individual with HPS1 remains well after undergoing lung transplantation [Lederer et al 2005]. A second lung transplantation has been performed but remains unreported.

Colitis.  The granulomatous colitis of HPS resembles Crohn's colitis and, as such, may respond to steroids and other anti-inflammatory agents. Remicade^® has also been used with benefit [Erzin et al 2006].

Prevention of Secondary Complications

Skin.  Skin care in HPS is dictated by the amount of pigment in the skin and the cutaneous response to sunlight. Protection from the sun should be provided to prevent burning, other skin damage, and skin cancer. In very sensitive individuals, sun exposure as short as five to ten minutes can be significant, while exposure of 30 minutes or more is usually significant in less sensitive individuals. Prolonged periods in the sun require skin protection with clothing (hats with brims, long sleeves and pants, and socks). For extremely sun-sensitive individuals, sun screens with a high SPF value (total blocks with SPF 45-50+) are appropriate; for less sun-sensitive individuals, sun screens with SPF values of 15 or above can be used.

Bleeding.  Individuals with HPS should consider obtaining a medical alert bracelet that explicitly describes the functional platelet defect, as the standard tests for bleeding dysfunction (platelet count, prothrombin time, partial thromboplastin time) are normal in HPS.

Pulmonary fibrosis.  Prior to the development of pulmonary fibrosis, attention should be paid to maximizing pulmonary function. This entails avoidance of cigarette smoke, prompt treatment of pulmonary infections, immunization with influenza and pneumococcal vaccines, and regular moderate exercise.

Surveillance

Eyes.  Annual ophthalmologic examination, including assessment of refractive error, is indicated.

Skin.  Over many years, exposure to the sun of lightly pigmented skin can result in coarse, rough, thickened skin (pachydermia), solar keratoses (premalignant lesions), and skin cancer. Both basal cell carcinoma and squamous cell carcinoma can develop. Although skin melanocytes are present in individuals with HPS, melanoma is rare. Examination for these findings should be performed at least annually.

Pulmonary fibrosis.  Pulmonary function testing should be performed annually in adults.

Colitis.  The colitis is suspected in those with a history of cramping, increased mucus in the stool, and rectal bleeding; colonoscopy is used to confirm the diagnosis.

Agents/Circumstances to Avoid

Bleeding.  All aspirin-containing products as well as activities that could involve the risk of a bleeding episode should be avoided.

Pulmonary fibrosis.  Cigarette smoking decreases pulmonary function and may worsen progression of pulmonary fibrosis.

Testing of Relatives at Risk

In families with HPS3, HPS5, or HPS6, the evaluation of apparently unaffected siblings may yield a positive diagnosis.

In individuals with HPS1 and HPS4, the diagnosis of HPS will be apparent because the hypopigmentation and nystagmus are clinically evident.

See Genetic Counseling for issues related to testing of at-risk relatives for genetic counseling purposes.

Therapies Under Investigation

Recent studies suggest a salutary effect on pulmonary function of the investigational drug pirfenidone in affected individuals with pulmonary function greater than 50% of normal [Gahl et al 2002]. Further clinical trials are ongoing.

Search ClinicalTrials.gov for access to information on clinical studies for a wide range of diseases and conditions.

Other

In general, opaque contact lenses or darkly tinted lenses do not improve visual function. Dark glasses may be helpful for individuals with albinism, but many prefer to go without dark glasses because they reduce vision.

No successful therapy for or prophylaxis against the pulmonary fibrosis of HPS exists. Steroids are often tried but have no apparent beneficial effect.

Genetics clinics are a source of information for individuals and families regarding the natural history, treatment, mode of inheritance, and genetic risks to other family members as well as information about available consumer-oriented resources. See the GeneTests Clinic Directory.

Support groups have been established for individuals and families to provide information, support, and contact with other affected individuals. The Resources section may include disease-specific and/or umbrella support organizations.

Genetic Counseling

Genetic counseling is the process of providing individuals and families with information on the nature, inheritance, and implications of genetic disorders to help them make informed medical and personal decisions. The following section deals with genetic risk assessment and the use of family history and genetic testing to clarify genetic status for family members. This section is not meant to address all personal, cultural, or ethical issues that individuals may face or to substitute for consultation with a genetics professional. To find a genetics or prenatal diagnosis clinic, see the GeneTests Clinic Directory. —ED.

Mode of Inheritance

All types of Hermansky-Pudlak syndrome (HPS) are inherited in an autosomal recessive manner.

Risk to Family Members

Parents of a proband

• The parents of an affected child are obligate heterozygotes and thus carry one mutant allele.
• Heterozygotes (carriers) are asymptomatic.

Sibs of a proband

• At conception, each sib of an affected individual has a 25% chance of being affected, a 50% chance of being an asymptomatic carrier, and a 25% chance of being neither affected nor a carrier.
• Once an at-risk sib is known to be unaffected, the chance of his/her being a carrier is 2/3.
• Heterozygotes are asymptomatic.

Offspring of a proband

• The offspring of an individual with HPS are obligate heterozygotes (carriers) for a mutant allele causing HPS.
• Rarely, families with two-generation pseudodominance have been identified; these result from an affected individual having children with a reproductive partner who is heterozygous (i.e., a carrier) for a mutant allele in the same HPS-causing gene.

Other family members of a proband.  Each sib of the proband's parents is at a 50% risk of being a carrier.

Carrier Detection

Carrier testing for the c.1470_1468dup16 duplication in HPS1 and the g.339_4260del3904, AF375663 deletion and c.1163+1G>A splice site mutation in HPS3 is available on a clinical basis. Carrier testing for other HPS1 sequence variants and mutations in HPS4 is available on a clinical basis once the mutations have been identified in the family.

Related Genetic Counseling Issues

Family planning.  The optimal time for determination of genetic risk, clarification of carrier status, and discussion of the availability of prenatal testing is before pregnancy.

DNA banking.  DNA banking is the storage of DNA (typically extracted from white blood cells) for possible future use. Because it is likely that testing methodology and our understanding of genes, mutations, and diseases will improve in the future, consideration should be given to banking DNA of affected individuals. DNA  banking is particularly relevant in situations in which molecular genetic testing is available on a research basis only and/or the sensitivity of currently available testing is less than 100%. See for a list of laboratories offering DNA banking.

Prenatal Testing

Prenatal diagnosis for pregnancies at 25% risk of inheriting two mutations in HPS1 (i.e., either two copies of c.1470_1468dup16, one of c.1470_1468dup16 and another HPS1 mutation, or two other HPS1 mutations), two copies of g.339_4260del3904 in HPS3, or two mutations in HPS4 is possible by analysis of DNA extracted from fetal cells obtained by amniocentesis usually performed at approximately 15-18 weeks' gestation or chorionic villus sampling (CVS) at approximately ten to 12 weeks' gestation.

Note: Gestational age is expressed as menstrual weeks calculated either from the first day of the last normal menstrual period or by ultrasound measurements.

No laboratories offering molecular genetic testing for prenatal diagnosis of other mutations which cause HPS are listed in the GeneTests Laboratory Directory. However, prenatal testing may be available for families in which the disease-causing mutations have been identified in an affected family member in a research or clinical laboratory. For laboratories offering custom prenatal testing, see .

Preimplantation genetic diagnosis (PGD) may be available for families in which the disease-causing mutations have been identified. For laboratories offering PGD, see .

Molecular Genetics

Information in the Molecular Genetics tables is current as of initial posting or most recent update. —ED.

HPS1

Gene symbol: The gene causing Hermansky-Pudlak syndrome 1 (HPS1) was originally named HPS, but is now referred to as HPS1.

Normal allelic variants: The normal HPS1 gene is 30.5 kb in length and has 20 exons coding for a cDNA of 2100 bp [Oh et al 1996 , Bailin et al 1997]. Four alternative splicing events have been described, including a common splice removing 99 bp of exon 9 [Wildenberg et al 1998]; this protein product lacks amino acids 257-289. A rare splicing event adds 43 nucleotides of the donor site of intron 6 and results in a frameshift. Two other splicing events can occur in untranslated regions of the HPS1 transcript. On northern blot analysis, the main transcript is 3.0 kb, but minor 3.9-kb and 4.4-kb species appear as well. A 1.5-kb transcript with the same 5' sequence as the published cDNA but with a different 3' sequence has been reported in bone marrow and melanoma cells. Eighteen non-pathologic DNA polymorphisms have been reported, including four that change amino acids (p.Gly283Trp, p.Pro491Arg, p.Arg603Gln, p.Val630Ile) [Shotelersuk & Gahl 1998]. A partial pseudogene of HPS1 exists [Huizing et al 2000a].

Pathologic allelic variants: At least 24 distinct mutations in HPS1 have been reported, and these have been found in different combinations in individuals with HPS [Oh et al 1996 , Oh et al 1998 , Shotelersuk et al 1998 , Shotelersuk & Gahl 1998 , Oetting & King 1999 , Hermos et al 2002 , Gonzalez-Conejero et al 2003 , Griffin et al 2005 , Ito et al 2005 , Iwakawa et al 2005]. All except four — p.Ile55del, p.Leu239Pro, p.Leu668Pro, and c.644+5G>A, NM_000195 (also known as IVS5+5G>A) — result in a truncated protein. This rarity of missense mutations suggests that most single base substitutions represent polymorphisms and not pathologic variants. Among the pathologic mutations, founder  effects have been reported for the c.1470_1468dup16 duplication in exon 15 (in northwestern Puerto Rico), for the H325PfsX452 mutation (in a Swiss Alpine village), and for a c.644+5G>A, NM_000195 splicing mutation in affected Japanese individuals. Otherwise, the most common reported mutations among non-Puerto Ricans involve the insertion or deletion of a C nucleotide in a run of eight Cs. Following the convention that the most 3' change in a repeat is arbitrarily assigned to be changed, these mutations are p.His325ProfsX452 (for the C insertion) and p.324ProfsX330 (for the C deletion). These mutations are both frameshifts that predict a new translational stop codon at amino acids 452 and 330 (and are also known as T322insC and T322delC, respectively). The tract of eight C nucleotides in this region is an apparent hot spot for mutation. Multiple other intragenic specific deletions and insertions have been reported. Other deletions include 369-371delATC, 494delT, 561delC, 624delG, 1168delG, 1178delG, 1395delC, 1581delA, and 1691delA. Insertions include 178insC, 532insC, 1528-1529insA, and insC974. Nonsense mutations are p.Glu133X, p.Arg131X, p.Trp583X, and p.Trp666X; splice site mutations are c.644+5G>A, NM_000195 and c.1990-2A>C, NM_000195 (also known as IVS17-2A>C).

Normal gene product: The protein product of HPS1 is a 700-amino acid peptide with a predicted molecular weight of 79.3 kd and without homology to other proteins. It has two potential N-linked glycosylation sites (residues 528 and 560) and a possible melanosomal localization signal, PLL, at the carboxy terminus. Although two transmembrane domains (at residues 79-95 and 369-396) have been proposed to exist, the protein is largely cytosolic in location, with a slight portion associating with membranes [Dell'Angelica et al 2000 , Oh et al 2000]. The function of the protein remains unknown, but may have to do with vesicle formation or trafficking [Huizing, Sarangarajan et al 2001 ; Sarangarajan et al 2001]. Cellular and biochemical evidence indicates that the HPS1 gene product interacts with the HPS4 protein in biogenesis of lysosome-related organelles complex-3 (BLOC-3) [Suzuki et al 2002 , Martina et al 2003 , Nazarian et al 2003 , Chiang et al 2003].

Abnormal gene product: The mutant alleles of HPS1 are generally predicted to produce truncated, dysfunctional proteins. Further understanding of the abnormal gene products awaits determination of the function of the normal HPS1 gene product.

AP3B1

Normal allelic variants: The organization of AP3B1 has been described for the mouse [Gorin et al 1999], and the human cDNA is expressed as a 4.2-kb transcript in a variety of tissues [Simpson et al 1997 , Dell'Angelica et al 1997]. The coding sequence is 3282 bp. There are 27 exons.

Pathologic allelic variants: The first AP3B1 mutations were reported in two brothers who were compound heterozygous for a 63-bp deletion causing loss of 21 amino acids (mutation p.Lys389_Thr411del) and a p.Leu580Arg substitution resulting from a missense mutation. A six-year-old boy with HPS2 has two nonsense mutations, p.Arg509X and p.Glu659X. A fourth individual has a missense mutation in exon 15 and a splice site mutation in intron 14 of AP3B1. Two Turkish siblings are homozygous for an 8168-bp deletion encompassing exon 15 and parts of introns 14 and 15 (mutation p.Thr491_Gln550del). Two Italian siblings are compound heterozygous for an insertion-deletion in exon 10 and an insertion of A in exon 16. Another individual is homozygous for a nonsense mutation in exon 8 of AP3B1.

Normal gene product: The product of AP3B1 is a 1094-amino acid peptide with a predicted mass of 121.35 kd. The protein has an amino-terminal region (residues 1-642), a hydrophilic span (residues 643-809), and a carboxy-terminal region (810-1094). The gene product is the beta-3A subunit of adaptor complex-3 (AP-3, also known as beta-3A adaptin), a heterotetrameric coat protein complex that forms intracellular vesicles (presumably lysosomes, melanosomes, and dense bodies) from the trans-Golgi network and endosomes in a clathrin-mediated fashion. Beta-3A adaptin interacts with the other AP-3 subunits to affect this function.

Abnormal gene product: Compound heterozygosity for the two in-frame mutations of AP3B1 results in a very small amount of beta-3A adaptin on western blot, reduced amounts of another AP-3 subunit (mu), and decreased internalization of certain integral lysosomal membrane proteins into fibroblasts [Dell'Angelica et al 1999]. Compound heterozygosity for the two nonsense mutations of AP3B1 produces no beta-3A adaptin on western blot and a more severe cellular phenotype, i.e., significant default trafficking of selected lysosomal membrane proteins through the plasma membrane [Huizing et al 2002]. Compound heterozygosity for the missense and splice site mutations result in cytotoxic T-lymphocytes with enlarged lytic granules that cannot move along microtubules and dock in secretory domains of the immunologic synapse [Clark et al 2003]. The Italian patients with an insertion-deletion and an insertion have natural killer cell dysfunction [Fontana et al 2006], and the person homozygous for a nonsense mutation in exon 8 had lymphohistiocytosis [Enders et al 2006].

HPS3

Normal allelic variants: The genomic organization of HPS3 has been described [Anikster et al 2001]. It has 17 exons coding for a cDNA of 3921 bp. The transcript is 4.4 kb in size.

Pathologic allelic variants: A founder mutation in central Puerto Rico, consisting of a g.339_4260del3904, AF375663 (also known as the 3.9-kb) deletion that removes all of exon 1 and 673 bp of intron 1, accounts for the bulk of the molecular pathology in HPS3. This mutant allele produces no HPS3 mRNA. A second founder mutation, c.1163+1G>A, NM_032383 (also known as 1303+1G>A or IVS5+1G>A), occurs among Ashkenazi Jews, causes skipping of exon 5, and produces negligible amounts of mRNA [Huizing, Anikster, Fitzpatrick et al 2001]. Other reported mutations include: three splice site mutations, c.1691+2T>G (also known as IVS9+2T>G), c.2481-2A>G (also known as IVS13-2A>G), and c.2589+1G>C (also known as 2729+1G>C); and a missense mutation, AF375663 : g.44101G>A, which creates a new splice site resulting in the insertion of an 89-bp alternative exon 16A and a missense mutation (R397W) [Huizing & Gahl 2002].

Normal gene product: The protein encoded by HPS3 has 1004 amino acids with a predicted molecular weight of 113.7 kd [Anikster et al 2001]. It is predicted to have no glycosylation sites or transmembrane regions, but to be 43% alpha-helix, 19% extended strand, 30% random coil, and 7% beta-turn. A clathrin binding motif exists at residues 172-176, and binding of the HPS3 protein to clathrin has been demonstrated [Helip-Wooley et al 2005]. The function of the gene product is not known, but it has been shown to interact within a complex including the products of HPS5 and HPS6 [DiPietro et al 2004 , Gautam et al 2004].

Abnormal gene product: The central Puerto Rican 3904-bp deletion produces no transcript and no protein. The c.1163+1G>A, NM_032383 (also known as 1303+1G>A or IVS5+1G>A) mutation eliminates exon 5, resulting in a premature translational stop at codon 350, which is predicted to produce a truncated protein if mRNA escapes the nonsense-mediated decay pathway. Similarly, truncated protein may be produced from the c.1691+2T>G (also known as IVS9+2T>G) splice mutant. The R397W allele is expected to produce a normally sized HPS3 product.

HPS4

Normal allelic variants: The genomic organization of HPS4 has been described [Anderson et al 2003]. HPS4 has 14 exons covering 32 kb of genomic DNA. Two transcripts of HPS4 differ at their 5' ends, with the major transcript providing a 708-amino acid peptide and the minor transcript producing a 703-amino acid protein. Eight non-pathogenic DNA polymorphisms have been reported, including four that change an amino acid [Anderson et al 2003].

Pathologic allelic variants: Reported mutations include p.Gln631X, c.2093_2094ins (also known as Q698insAAGCA), p.Phe19delThr, p.Gln181X, c.947_961dupGCTTGTCCAGATGGCAGGAAGGAG, c.947_961dup24, (p.Glu316_Asn325dupACPDGRKE) (also known as A316ins24 bp) [Suzuki et al 2002], p.His154Arg, p.Arg217X, p.Glu138X, p.Gly222X, p.Arg217X [Anderson et al 2003], and c.1865delC (p.Pro685LeufsX30) (also known as 685delC) [Bachli et al 2004].

Note: The numbering of all HPS4 mutations is based on Genbank reference sequence AY043416 .

Normal gene product: The protein encoded by HPS4 has 708 amino acids with a predicted molecular weight of 76.9 kd [Suzuki et al 2002]. The function of the gene  product is not known, but it has been shown to interact with the HPS1 gene product and is considered to be involved in intracellular vesicle biogenesis [Suzuki et al 2002].

Abnormal gene product: No information is available on the abnormal gene products of HPS4.

HPS5

Normal allelic variants: The genomic organization of HPS5 has been described [Huizing et al 2004]. HPS5 has 23 exons, spans 43.5 kb of genomic DNA, and has three splice variants, the longest of which is 4.8 kb and contains 23 exons encoding an 1129-amino acid protein. A second splice variant differs in the 5'UTR and lacks the first 114 amino acids coded for by exon 2. The third variant resembles variant 2 in lacking the first 114 amino acids, but also lacks a portion of exon 1 [Huizing et al 2004].

Pathologic allelic variants: Reported mutations include c.2025_2028delAGTT (p.Val676ValfsX8) (also known as L675-V676TTAGTT>TT) [Zhang et al 2003], c.2624delT (p.Leu875CysfsX) (also known as L875delT), p.Arg865X, c.879insC (p.293GlnfsX) (also known as P293insC), c.2929_2930dupGA (also known as T977insGA), p.Leu624Arg, and p.Thr1098Ile [Huizing et al 2004].

Note: Mutation designations are based on Genbank sequence NM_181507.

Normal gene product: The HPS5 protein has 1129 amino acids (127.4 kd) and contains two WD40 domains at low statistical likelihood [Zhang et al 2003]. It interacts with the products of the HPS3 and HPS6 genes [DiPietro et al 2004 , Gautam et al 2004]. HPS5 function is not known, but in its absence, LAMP3-containing fibroblast vesicles cluster around the nucleus and fail to normally populate the cell periphery [Huizing et al 2004].

Abnormal gene product: No information is available on the abnormal gene products of HPS5.

HPS6

Normal allelic variants: HPS6 contains a 2418-bp open reading frame along with 93 bp of 5' untranslated sequence and 110 bp of 3' untranslated sequence all within a single exon [Zhang et al 2003].

Pathologic allelic variants: A homozygous 4-bp deletion, c.1713_1716del TCTG (also known as C571-L572, or TGTCTG>TG) has been described in a 39-year-old woman. It predicts the truncation of HPS6 protein at codon 610.

Normal gene product: The human HPS6 gene product has 775 amino acid residues, with no common domains, signal sequences, or transmembrane regions [Zhang et al 2003].

Abnormal gene product: No information is available on the abnormal gene products of HPS6.

DTNBP1

Normal allelic variants: The genomic organization of the human DTNBP1 gene has not been described, although the gene is known to contain ten exons. Six neutral polymorphisms have been reported [Li et al 2003].

Pathologic allelic variants: One nonsense mutation, c.307C>T (p.Gln103X), has been described [Li et al 2003].

Normal gene product: The protein encoded by DTNBP1 is dysbindin (also known as dystrobrevin binding protein 1), which binds to dystrobrevins in muscle and non-muscle cells and is also a component of biogenesis of lysosome-related organelles complex 1 (BLOC-1) [Falcon-Perez et al 2002 , Moriyama & Bonifacino 2002 , Ciciotte et al 2003].

Abnormal gene product: No information is available on the abnormal gene products of DTNBP1.

BLOC1S3

Normal allelic variants: BLOC1S3 contains a single coding exon [Morgan et al 2006].

Pathologic allelic variants: One mutation in BLOC1S3, p.Gly150ArgfsX75, has been identified in the homozygous state in affected individuals of a single consanguineous Pakistani family [Morgan et al 2006].

Normal gene product: The protein encoded by BLOC1S3 has 203 amino acids and combines with seven other proteins to form BLOC1. BLOC1S3 contains an unstructured amino terminal domain followed by an alpha-helical domain. The function of the BLOC1S3 subunit is unknown; BLOC1 is hypothesized to regulate SNARE complex formation in the endocytic pathway.

Abnormal gene product: No information is available on the abnormal gene products of BLOC1S3.

Resources

GeneReviews provides information about selected national organizations and resources for the benefit of the reader. GeneReviews is not responsible for information provided by other organizations. -ED.

References

Published Statements and Policies Regarding Genetic Testing

No specific guidelines regarding genetic testing for this disorder have been developed.

Literature Cited

• Anderson PD, Huizing M, Claassen DA, White J, Gahl WA (2003) Hermansky-Pudlak syndrome type 4 (HPS-4): clinical and molecular characteristics. Hum Genet 113:10-7 [Medline]
  
  
• Anikster Y, Huizing M, White J, Shevchenko YO, Fitzpatrick DL, Touchman JW, Compton JG, Bale SJ, Swank RT, Gahl WA, Toro JR (2001) Mutation of a new gene causes a unique form of Hermansky-Pudlak syndrome in a genetic isolate of central Puerto Rico. Nat Genet 28:376-80 [Medline]
  
  
• Avila NA, Brantly M, Premkumar A, Huizing M, Dwyer A, Gahl WA (2002) Hermansky-Pudlak syndrome: radiography and CT of the chest compared with pulmonary function tests and genetic studies. AJR Am J Roentgenol 179:887-92 [Medline]
  
  
• Bachli EB, Brack T, Eppler E, Stallmach T, Trueb RM, Huizing M, Gahl WA (2004) Hermansky-Pudlak syndrome type 4 in a patient from Sri Lanka with pulmonary fibrosis. Am J Med Genet 127A:201-7 [Medline]
  
  
• Bailin T, Oh J, Feng GH, Fukai K, Spritz RA (1997) Organization and nucleotide sequence of the human Hermansky-Pudlak syndrome (HPS) gene. J Invest Dermatol 108:923-7 [Medline]
  
  
• Brantly M, Avila NA, Shotelersuk V, Lucero C, Huizing M, Gahl WA (2000) Pulmonary function and high-resolution CT findings in patients with an inherited form of pulmonary fibrosis, Hermansky-Pudlak syndrome, due to mutations in HPS-1. Chest 117:129-36 [Medline]
  
  
• Chiang PW, Oiso N, Gautam R, Suzuki T, Swank RT, Spritz RA (2003) The Hermansky-Pudlak syndrome 1 (HPS1) and HPS4 proteins are components of two complexes, BLOC-3 and BLOC-4, involved in the biogenesis of lysosome-related organelles. J Biol Chem 278:20332-7 [Medline]
  
  
• Ciciotte SL, Gwynn B, Moriyama K, Huizing M, Gahl WA, Bonifacino JS, Peters LL (2003) Cappuccino, a mouse model of Hermansky-Pudlak syndrome, encodes a novel protein that is part of the pallidin-muted complex (BLOC-1). Blood 101:4402-7 [Medline]
  
  
• Clark RH, Stinchcombe JC, Day A, Blott E, Booth S, Bossi G, Hamblin T, Davies EG, Griffiths GM (2003) Adaptor protein 3-dependent microtubule-mediated movement of lytic granules to the immunological synapse. Nat Immunol 4:1111-20 [Medline]
  
  
• Cordova A, Barrios NJ, Ortiz I, Rivera E, Cadilla C, Santiago-Borrero PJ (2005) Poor response to desmopressin acetate (DDAVP) in children with Hermansky-Pudlak syndrome. Pediatr Blood Cancer 44:51-4 [Medline]
  
  
• Dell'Angelica EC, Aguilar RC, Wolins N, Hazelwood S, Gahl WA, Bonifacino JS (2000) Molecular characterization of the protein encoded by the Hermansky- Pudlak syndrome type 1 gene. J Biol Chem 275:1300-6 [Medline]
  
  
• Dell'Angelica EC, Ooi CE, Bonifacino JS (1997) Beta3A-adaptin, a subunit of the adaptor-like complex AP-3. J Biol Chem 272:15078-84 [Medline]
  
  
• Dell'Angelica EC, Shotelersuk V, Aguilar RC, Gahl WA, Bonifacino JS (1999) Altered trafficking of lysosomal proteins in Hermansky-Pudlak syndrome due to mutations in the beta 3A subunit of the AP-3 adaptor. Mol Cell 3:11-21 [Medline]
  
  
• Di Pietro SM, Falcon-Perez JM, Dell'Angelica EC (2004) Characterization of BLOC-2, a complex containing the Hermansky-Pudlak syndrome proteins HPS3, HPS5 and HPS6. Traffic 5:276-83 [Medline]
  
  
• Enders A, Zieger B, Schwarz K, Yoshimi A, Speckmann C, Knoepfle EM, Kontny U, Muller C, Nurden A, Rohr J, Henschen M, Pannicke U, Niemeyer C, Nurden P, Ehl S (2006) Lethal hemophagocytic lymphohistiocytosis in Hermansky-Pudlak syndrome type II. Blood 108:81-7 [Medline]
  
  
• Erzin Y, Cosgun S, Dobrucali A, Tasyurekli M, Erdamar S, Tuncer M (2006) Complicated granulomatous colitis in a patient with Hermansky-Pudlak syndrome, successfully treated with infliximab. Acta Gastroenterol Belg 69:213-6 [Medline]
  
  
• Falcon-Perez JM, Starcevic M, Gautam R, Dell'Angelica EC (2002) BLOC-1, a novel complex containing the pallidin and muted proteins involved in the biogenesis of melanosomes and platelet-dense granules. J Biol Chem 277:28191-9 [Medline]
  
  
• Fontana S, Parolini S, Vermi W, Booth S, Gallo F, Donini M, Benassi M, Gentili F, Ferrari D, Notarangelo LD, Cavadini P, Marcenaro E, Dusi S, Cassatella M, Facchetti F, Griffiths GM, Moretta A, Notarangelo LD, Badolato R (2006) Innate immunity defects in Hermansky-Pudlak type 2 syndrome. Blood 107:4857-64 [Medline]
  
  
• Gahl WA, Brantly M, Kaiser-Kupfer MI, Iwata F, Hazelwood S, Shotelersuk V, Duffy LF, Kuehl EM, Troendle J, Bernardini I (1998) Genetic defects and clinical characteristics of patients with a form of oculocutaneous albinism (Hermansky-Pudlak syndrome). N Engl J Med 338:1258-64 [Medline]
  
  
• Gahl WA, Brantly M, Troendle J, Avila NA, Padua A, Montalvo C, Cardona H, Calis KA, Gochuico B (2002) Effect of pirfenidone on the pulmonary fibrosis of Hermansky-Pudlak syndrome. Mol Genet Metab 76:234-42 [Medline]
  
  
• Gautam R, Chintala S, Li W, Zhang Q, Tan J, Novak EK, Di Pietro SM, Dell'Angelica EC, Swank RT (2004) The Hermansky-Pudlak syndrome 3 (cocoa) protein is a component of the biogenesis of lysosome-related organelles complex-2 (BLOC-2). J Biol Chem 279:12935-42 [Medline]
  
  
• Gonzalez-Conejero R, Rivera J, Escolar G, Zuazu-Jausoro I, Vicente V, Corral J (2003) Molecular, ultrastructural and functional characterization of a Spanish family with Hermansky-Pudlak syndrome: role of insC974 in platelet function and clinical relevance. Br J Haematol 123:132-8 [Medline]
  
  
• Gorin MB, Rigatti BW, Feng L, Swank RT (1999) The genomic structure of the beta3A subunit gene of the AP-3 adaptor complex.The gene responsible for the pearl mouse and a form of human Hermansky-Pudlak Syndrome. Invest Ophthalmol Vis Sci 40:2504B379
  
  
• Gradstein L, FitzGibbon EJ, Tsilou ET, Rubin BI, Huizing M, Gahl WA (2005) Eye movement abnormalities in hermansky-pudlak syndrome. J AAPOS 9:369-78 [Medline]
  
  
• Griffin AE, Cobb BR, Anderson PD, Claassen DA, Helip-Wooley A, Huizing M, Gahl WA (2005) Detection of hemizygosity in Hermansky-Pudlak syndrome by quantitative real-time PCR. Clin Genet 68:23-30 [Medline]
  
  
• Gunay-Aygun M, Huizing M, Gahl WA (2004) Molecular defects that affect platelet dense granules. Semin Thromb Hemost 30:537-47 [Medline]
  
  
• Helip-Wooley A, Westbroek W, Dorward H, Mommaas M, Boissy RE, Gahl WA, Huizing M (2005) Association of the Hermansky-Pudlak syndrome type-3 protein with clathrin. BMC Cell Biol 6:33 [Medline]
  
  
• Hermos CR, Huizing M, Kaiser-Kupfer MI, Gahl WA (2002) Hermansky-Pudlak syndrome type 1: gene organization, novel mutations, and clinical molecular review of non-Puerto Rican cases. Hum Mutat 20:482 [Medline]
  
  
• Huizing M, Anikster Y, Fitzpatrick DL, Jeong AB, D'Souza M, Rausche M, Toro JR, Kaiser-Kupfer MI, White JG, Gahl WA (2001) Hermansky-Pudlak syndrome type 3 in Ashkenazi Jews and other non-Puerto Rican patients with hypopigmentation and platelet storage-pool deficiency. Am J Hum Genet 69:1022-32 [Medline]
  
  
• Huizing M, Anikster Y, Gahl WA (2000a) Characterization of a partial pseudogene homologous to the Hermansky-Pudlak syndrome gene HPS-1; relevance for mutation detection. Hum Genet 106:370-3 [Medline]
  
  
• Huizing M, Anikster Y, Gahl WA (2000b) Hermansky-Pudlak syndrome and related disorders of organelle formation. Traffic 1:823-35 [Medline]
  
  
• Huizing M, Anikster Y, Gahl WA (2001) Hermansky-Pudlak syndrome and Chediak-Higashi syndrome: disorders of vesicle formation and trafficking. Thromb Haemost 86:233-45 [Medline]
  
  
• Huizing M and Gahl WA (2002) Disorders of vesicles of lysosomal lineage: the Hermansky-Pudlak syndromes. Curr Mol Med 2:451-67 [Medline]
  
  
• Huizing M, Hess R, Dorward H, Claassen DA, Helip-Wooley A, Kleta R, Kaiser-Kupfer MI, White JG, Gahl WA (2004) Cellular, molecular and clinical characterization of patients with Hermansky-Pudlak syndrome type 5. Traffic 5:711-22 [Medline]
  
  
• Huizing M, Parkes JM, Helip-Wooley A, White JG, Gahl WA (2007) Platelet alpha granules in BLOC-2 and BLOC-3 subtypes of Hermansky-Pudlak syndrome. Platelets 18:150-7 [Medline]
  
  
• Huizing M, Sarangarajan R, Strovel E, Zhao Y, Gahl WA, Boissy RE (2001) AP-3 mediates tyrosinase but not TRP-1 trafficking in human melanocytes. Mol Biol Cell 12:2075-85 [Medline]
  
  
• Huizing M, Scher CD, Strovel E, Fitzpatrick DL, Hartnell LM, Anikster Y, Gahl WA (2002) Nonsense mutations in ADTB3A cause complete deficiency of the beta3A subunit of adaptor complex-3 and severe Hermansky-Pudlak syndrome type 2. Pediatr Res 51:150-8 [Medline]
  
  
• Hussain N, Quezado M, Huizing M, Geho D, White JG, Gahl W, Mannon P (2006) Intestinal disease in Hermansky-Pudlak syndrome: occurrence of colitis and relation to genotype. Clin Gastroenterol Hepatol 4:73-80 [Medline]
  
  
• Introne W, Boissy RE, Gahl WA (1999) Clinical, molecular, and cell biological aspects of Chediak-Higashi syndrome. Mol Genet Metab 68:283-303 [Medline]
  
  
• Ito S, Suzuki T, Inagaki K, Suzuki N, Takamori K, Yamada T, Nakazawa M, Hatano M, Takiwaki H, Kakuta Y, Spritz RA, Tomita Y (2005) High frequency of Hermansky-Pudlak syndrome type 1 (HPS1) among Japanese albinism patients and functional analysis of HPS1 mutant protein. J Invest Dermatol 125:715-20 [Medline]
  
  
• Iwakawa J, Matsuyama W, Watanabe M, Yamamoto M, Oonakahara K, Machida K, Higashimoto I, Niiyama T, Osame M, Arimura K (2005) Hermansky-Pudlak syndrome with a novel mutation. Intern Med 44:733-8 [Medline]
  
  
• Iwata F, Reed GF, Caruso RC, Kuehl EM, Gahl WA, Kaiser-Kupfer MI (2000) Correlation of visual acuity and ocular pigmentation with the 16-bp duplication in the HPS-1 gene of Hermansky-Pudlak syndrome, a form of albinism. Ophthalmology 107:783-9 [Medline]
  
  
• Jung J, Bohn G, Allroth A, Boztug K, Brandes G, Sandrock I, Schaffer AA, Rathinam C, Kollner I, Beger C, Schilke R, Welte K, Grimbacher B, Klein C (2006) Identification of a homozygous deletion in the AP3B1 gene causing Hermansky-Pudlak syndrome, type 2. Blood 108:362-9 [Medline]
  
  
• King RA, Hearing VJ, Creel DJ, Oetting WS (2001) Albinism. In: Scriver CR, Beaudet AL, Sly WS, Valle DL (eds) The Metabolic and Molecular Bases of Inherited Disease, 8 ed. Vol 4. McGraw-Hill, New York, pp 5587-627
  
  
• Kingman CE, Kadir RA, Lee CA, Economides DL (2004) The use of levonorgestrel-releasing intrauterine system for treatment of menorrhagia in women with inherited bleeding disorders. BJOG 111:1425-8 [Medline]
  
  
• Lederer DJ, Kawut SM, Sonett JR, Vakiani E, Seward SL Jr, White JG, Wilt JS, Marboe CC, Gahl WA, Arcasoy SM (2005) Successful bilateral lung transplantation for pulmonary fibrosis associated with the Hermansky-Pudlak syndrome. J Heart Lung Transplant 24:1697-9 [Medline]
  
  
• Li W, Zhang Q, Oiso N, Novak EK, Gautam R, O'Brien EP, Tinsley CL, Blake DJ, Spritz RA, Copeland NG, Jenkins NA, Amato D, Roe BA, Starcevic M, Dell'Angelica EC, Elliott RW, Mishra V, Kingsmore SF, Paylor RE, Swank RT (2003) Hermansky-Pudlak syndrome type 7 (HPS-7) results from mutant dysbindin, a member of the biogenesis of lysosome-related organelles complex 1 (BLOC-1). Nat Genet 35:84-9 [Medline]
  
  
• Martina JA, Moriyama K, Bonifacino JS (2003) BLOC-3, a protein complex containing the Hermansky-Pudlak syndrome gene products HPS1 and HPS4. J Biol Chem 278:29376-84 [Medline]
  
  
• Morgan NV, Pasha S, Johnson CA, Ainsworth JR, Eady RA, Dawood B, McKeown C, Trembath RC, Wilde J, Watson SP, Maher ER (2006) A germline mutation in BLOC1S3/reduced pigmentation causes a novel variant of Hermansky-Pudlak syndrome (HPS8). Am J Hum Genet 78:160-6 [Medline]
  
  
• Moriyama K and Bonifacino JS (2002) Pallidin is a component of a multi-protein complex involved in the biogenesis of lysosome-related organelles. Traffic 3:666-77 [Medline]
  
  
• Nazarian R, Falcon-Perez JM, Dell'Angelica EC (2003) Biogenesis of lysosome-related organelles complex 3 (BLOC-3): a complex containing the Hermansky-Pudlak syndrome (HPS) proteins HPS1 and HPS4. Proc Natl Acad Sci U S A 100:8770-5 [Medline]
  
  
• Oetting WS and King RA (1999) Molecular basis of albinism: mutations and polymorphisms of pigmentation genes associated with albinism. Hum Mutat 13:99-115 [Medline]
  
  
• Oh J, Bailin T, Fukai K, Feng GH, Ho L, Mao JI, Frenk E, Tamura N, Spritz RA (1996) Positional cloning of a gene for Hermansky-Pudlak syndrome, a disorder of cytoplasmic organelles. Nat Genet 14:300-6 [Medline]
  
  
• Oh J, Ho L, Ala-Mello S, Amato D, Armstrong L, Bellucci S, Carakushansky G, Ellis JP, Fong CT, Green JS, Heon E, Legius E, Levin AV, Nieuwenhuis HK, Pinckers A, Tamura N, Whiteford ML, Yamasaki H, Spritz RA (1998) Mutation analysis of patients with Hermansky-Pudlak syndrome: a frameshift hot spot in the HPS gene and apparent locus heterogeneity. Am J Hum Genet 62:593-8 [Medline]
  
  
• Oh J, Liu ZX, Feng GH, Raposo G, Spritz RA (2000) The Hermansky-Pudlak syndrome (HPS) protein is part of a high molecular weight complex involved in biogenesis of early melanosomes. Hum Mol Genet 9:375-85 [Medline]
  
  
• Santiago Borrero PJ, Rodriguez-Perez Y, Renta JY, Izquierdo NJ, Del Fierro L, Munoz D, Molina NL, Ramirez S, Pagan-Mercado G, Ortiz I, Rivera-Caragol E, Spritz RA, Cadilla CL (2006) Genetic testing for oculocutaneous albinism type 1 and 2 and Hermansky-Pudlak syndrome type 1 and 3 mutations in Puerto Rico. J Invest Dermatol 126:85-90 [Medline]
  
  
• Sarangarajan R, Budev A, Zhao Y, Gahl WA, Boissy RE (2001) Abnormal translocation of tyrosinase and tyrosinase related protein-1 in cutaneous melanocytes of Hermansky-Pudlak syndrome and in melanoma cells transfected with anti-sense HPS1 cDNA. J Invest Derm 117-641-6 [Medline]
  
  
• Shotelersuk V, Dell'Angelica EC, Hartnell L, Bonifacino JS, Gahl WA (2000) A new variant of Hermansky-Pudlak syndrome due to mutations in a gene responsible for vesicle formation. Am J Med 108:423-7 [Medline]
  
  
• Shotelersuk V and Gahl WA (1998) Hermansky-Pudlak syndrome: models for intracellular vesicle formation. Mol Genet Metab 65:85-96 [Medline]
  
  
• Shotelersuk V, Hazelwood S, Larson D, Iwata F, Kaiser-Kupfer MI, Kuehl E, Bernardini I, Gahl WA (1998) Three new mutations in a gene causing Hermansky-Pudlak syndrome: clinical correlations. Mol Genet Metab 64:99-107 [Medline]
  
  
• Simpson F, Peden AA, Christopoulou L, Robinson MS (1997) Characterization of the adaptor-related protein complex, AP-3. J Cell Biol 137:835-45 [Medline]
  
  
• Suzuki T, Wei L, Zhang Q, Karim A, Novak EK, Sviderskaya EV, Hill SP, Bennett DC, Levin AV, Nieuwenhuis HK, Fong C-T, Castellan C, Miterski B, Swank RT, Spritz RA (2002) Hermansky-Pudlak syndrome is caused by mutations in HPS4, the human homolog of the mouse light-ear gene. Nat Genet 30:321-4 [Medline]
  
  
• Toro J, Turner M, Gahl WA (1999) Dermatologic manifestations of Hermansky-Pudlak syndrome in patients with and without a 16-base pair duplication in the HPS1 gene. Arch Dermatol 135:774-80 [Medline]
  
  
• Wildenberg SC, Fryer JP, Gardner JM, Oetting WS, Brilliant MH, King RA (1998) Identification of a novel transcript produced by the gene responsible for the Hermansky-Pudlak syndrome in Puerto Rico. J Invest Dermatol 110:777-81 [Medline]
  
  
• Witkop CJ, Krumwiede M, Sedano H, White JG (1987) Reliability of absent platelet dense bodies as a diagnostic criterion for Hermansky-Pudlak syndrome. Am J Hematol 26:305-11 [Medline]
  
  
• Witkop CJ, Quevedo WC, Fitzpatrick TB, King RA (1989) Albinism. In: Scriver CR, Beaudet AL, Sly WS, Valle DL (eds) The Metabolic and Molecular Basis of Inherited Disease, 6 ed, Vol 2. McGraw-Hill, New York, pp 2905-47
  
  
• Zhang Q, Zhao B, Li W, Oiso N, Novak EK, Rusiniak ME, Gautam R, Chintala S, O'Brien EP, Zhang Y, Roe BA, Elliott RW, Eicher EM, Liang P, Kratz C, Legius E, Spritz RA, O'Sullivan TN, Copeland NG, Jenkins NA, Swank RT (2003) Ru2 and Ru encode mouse orthologs of the genes mutated in human Hermansky-Pudlak syndrome types 5 and 6. Nat Genet 33:145-53 [Medline]
  
  

Suggested Readings

• Bonifacino JS (2004) Insights into the biogenesis of lysosome-related organelles from the study of the Hermansky-Pudlak syndrome. Ann N Y Acad Sci 1038:103-14 [Medline]
  
  
• Di Pietro SM and Dell'Angelica EC (2005) The cell biology of Hermansky-Pudlak syndrome: recent advances. Traffic 6:525-33 [Medline]
  
  
• Gautam R, Novak EK, Tan J, Wakamatsu K, Ito S, Swank RT (2006) Interaction of Hermansky-Pudlak Syndrome genes in the regulation of lysosome-related organelles. Traffic 7:779-92 [Medline]
  
  
• King RA, Hearing VJ, Creel DJ, Oetting WS (revised 2002) Albinism. In: Scriver CR, Beaudet AL, Sly WS, Valle D, Vogelstein B (eds) The Metabolic and Molecular Bases of Inherited Disease (OMMBID), McGraw-Hill, New York, Chap 220. www.ommbid.com
  
  
• Summers CG, Knobloch WH, Witkop CJ Jr, King RA (1988) Hermansky-Pudlak syndrome. Ophthalmic findings. Ophthalmology 95:545-54 [Medline]
  
  
• Swank RT, Novak EK, McGarry MP, Rusiniak ME, Feng L (1998) Mouse models of Hermansky Pudlak syndrome: a review. Pigment Cell Res 11:60-80 [Medline]
  
  
• Wei ML (2006) Hermansky-Pudlak syndrome: a disease of protein trafficking and organelle function. Pigment Cell Res 19:19-42 [Medline]
  
  

Author Information